Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 369209
End position: 369232
Length: 24

DNA sequence
>NC_014205, from 369209 to 369232 (24 bp); Staphylothermus hellenicus DSM 12710 ATATATACATATATATTTATATAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 368771-369346	Sequence	Shell_0410 - cobalt transport protein (Protein is coded in complementary strand; from 369346 to 368771)