Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 404650
End position: 404676
Length: 27

DNA sequence
>NC_014205, from 404650 to 404676 (27 bp); Staphylothermus hellenicus DSM 12710 TTGTAGTTGTAGTAGTTGTTGTGGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 404418-405998	Sequence	Shell_0451 - FG-GAP repeat protein (Protein is coded in complementary strand; from 405998 to 404418)