Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 484492
End position: 484515
Length: 24

DNA sequence
>NC_014205, from 484492 to 484515 (24 bp); Staphylothermus hellenicus DSM 12710 TTGGTATGGGTATTGGTATGGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 484205-484588	Sequence	Shell_0526 - hypothetical protein (Protein is coded in complementary strand; from 484588 to 484205)