Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 627598
End position: 627624
Length: 27

DNA sequence
>NC_014205, from 627598 to 627624 (27 bp); Staphylothermus hellenicus DSM 12710 TTGTTGTAGTTGTAGTAGTTGTTGGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 627447-629624	Sequence	Shell_0669 - metallophosphoesterase (Protein is coded in complementary strand; from 629624 to 627447)