Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 650496
End position: 650522
Length: 27

DNA sequence
>NC_014205, from 650496 to 650522 (27 bp); Staphylothermus hellenicus DSM 12710 GCTTTTGTTGCATTTGTTGCTTTTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 650415-650618	Sequence	Shell_0687 - hypothetical protein (Protein is coded in complementary strand; from 650618 to 650415)