Sequence retrieval

Genome: Staphylothermus hellenicus DSM 12710
Start position: 770325
End position: 770348
Length: 24

DNA sequence
>NC_014205, from 770325 to 770348 (24 bp); Staphylothermus hellenicus DSM 12710 TGTTGTTGTAGTTGTCGTTGTAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 770116-772155	Sequence	Shell_0803 - family 5 extracellular solute-binding protein (Protein is coded in complementary strand; from 772155 to 770116)