Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 1082296
End position: 1082319
Length: 24

DNA sequence
>NC_014219, from 1082296 to 1082319 (24 bp); Bacillus selenitireducens MLS10 TCGTTCTCATTCTCATTCTCGTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1078708-1082496	Sequence	Bsel_0948 - hypothetical protein (Protein is coded in complementary strand; from 1082496 to 1078708)