Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 1334560
End position: 1334586
Length: 27

DNA sequence
>NC_014219, from 1334560 to 1334586 (27 bp); Bacillus selenitireducens MLS10 GATGATGACGATGACGACGATGATGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1334126-1334590	Sequence	Bsel_1156 - SUF system FeS assembly protein, NifU family