Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 2472273
End position: 2472296
Length: 24

DNA sequence
>NC_014219, from 2472273 to 2472296 (24 bp); Bacillus selenitireducens MLS10 TGATCATGGTCATGATCGTGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2471742-2472965	Sequence	Bsel_2250 - periplasmic solute-binding protein (Protein is coded in complementary strand; from 2472965 to 2471742)