Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 2737522
End position: 2737548
Length: 27

DNA sequence
>NC_014219, from 2737522 to 2737548 (27 bp); Bacillus selenitireducens MLS10 CATCGCCTCCATCACCTCCATCACCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2736413-2737534	Sequence	Bsel_2513 - PfkB domain-containing protein (Protein is coded in complementary strand; from 2737534 to 2736413)