Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 2907077
End position: 2907139
Length: 63

DNA sequence
>NC_014219, from 2907077 to 2907139 (63 bp); Bacillus selenitireducens MLS10 ACGCTCTTCTATCTGATCGAGACGCTCTTCTATCTGATCAAACCGCTTGTCCATCTGATCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2906736-2907269	Sequence	Bsel_2676 - hypothetical protein (Protein is coded in complementary strand; from 2907269 to 2906736)