Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 2983960
End position: 2983983
Length: 24

DNA sequence
>NC_014219, from 2983960 to 2983983 (24 bp); Bacillus selenitireducens MLS10 AATAACAAAAACAATAAAAATAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2983510-2983995	Sequence	Bsel_2752 - hypothetical protein (Protein is coded in complementary strand; from 2983995 to 2983510)