Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 3304979
End position: 3305002
Length: 24

DNA sequence
>NC_014219, from 3304979 to 3305002 (24 bp); Bacillus selenitireducens MLS10 CGGCTCAGGCTCCGGTTCAGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3304428-3305480	Sequence	Bsel_3069 - NLP/P60 protein (Protein is coded in complementary strand; from 3305480 to 3304428)