Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 3380827
End position: 3380889
Length: 63

DNA sequence
>NC_014219, from 3380827 to 3380889 (63 bp); Bacillus selenitireducens MLS10 TCGTCGTTCATTGGATCGTTATCTTCCATCATTGGATCATTATCTTCCATCATTGGATCATTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3380821-3380988	Sequence	Bsel_3131 - hypothetical protein (Protein is coded in complementary strand; from 3380988 to 3380821)