Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 3458396
End position: 3458419
Length: 24

DNA sequence
>NC_014219, from 3458396 to 3458419 (24 bp); Bacillus selenitireducens MLS10 CAAGGTCCAGGTCAAAGTCAAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3458002-3459669	Sequence	Bsel_3203 - arginyl-tRNA synthetase (Protein is coded in complementary strand; from 3459669 to 3458002)