Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 3537290
End position: 3537313
Length: 24

DNA sequence
>NC_014219, from 3537290 to 3537313 (24 bp); Bacillus selenitireducens MLS10 AGAAAACCTGAAAACCAGAGAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3536885-3537481	Sequence	Bsel_3273 - CDP-alcohol phosphatidyltransferase (Protein is coded in complementary strand; from 3537481 to 3536885)