Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 646306
End position: 646335
Length: 30

DNA sequence
>NC_014219, from 646306 to 646335 (30 bp); Bacillus selenitireducens MLS10 GTTTGTTTCACTTTGTGTCATTTTGTCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 646324-648222	Sequence	Bsel_0603 - GAF modulated sigma54 specific transcriptional regulator (Protein is coded in complementary strand; from 648222 to 646324)