Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 716662
End position: 716691
Length: 30

DNA sequence
>NC_014219, from 716662 to 716691 (30 bp); Bacillus selenitireducens MLS10 CCGGCACCAGCACCAGCACCGGCTCCGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 715523-723799	Sequence	Bsel_0659 - fibronectin type III domain-containing protein