Sequence retrieval

Genome: Bacillus selenitireducens MLS10
Start position: 812490
End position: 812534
Length: 45

DNA sequence
>NC_014219, from 812490 to 812534 (45 bp); Bacillus selenitireducens MLS10 GGAAGATCCATCAGCTGAATATGCATCAGCTGAAGATCGATCAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 810336-812741	Sequence	Bsel_0737 - PAS/PAC sensor-containing diguanylate cyclase/phosphodiesterase