Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2243967
End position: 2243990
Length: 24

DNA sequence
>NC_014297, from 2243967 to 2243990 (24 bp); Halalkalicoccus jeotgali B3 GAACCCGAACCGGAGCCCGAATCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2243794-2245128	Sequence	HacjB3_12135 - Polysaccharide deacetylase domain-containing protein