Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 1064147
End position: 1064173
Length: 27

DNA sequence
>NC_014297, from 1064147 to 1064173 (27 bp); Halalkalicoccus jeotgali B3 GACCCCGAGGATCCCGAGGACGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1063770-1064663	Sequence	HacjB3_05690 - ABC-2 type transporter (Protein is coded in complementary strand; from 1064663 to 1063770)