Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 1105556
End position: 1105579
Length: 24

DNA sequence
>NC_014297, from 1105556 to 1105579 (24 bp); Halalkalicoccus jeotgali B3 CGTCGGCGTCGTCGCCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1103488-1105878	Sequence	HacjB3_05890 - zinc-transporting ATPase (Protein is coded in complementary strand; from 1105878 to 1103488)