Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 1144702
End position: 1144725
Length: 24

DNA sequence
>NC_014297, from 1144702 to 1144725 (24 bp); Halalkalicoccus jeotgali B3 GAAGTCGTAGTCGTAGTCGGAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1144079-1144744	Sequence	HacjB3_06095 - Haloacid dehalogenase domain-containing protein hydrolase (Protein is coded in complementary strand; from 1144744 to 1144079)