Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 1344129
End position: 1344152
Length: 24

DNA sequence
>NC_014297, from 1344129 to 1344152 (24 bp); Halalkalicoccus jeotgali B3 ACATCTACATCAATATCTACATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1344090-1344374	Sequence	HacjB3_07210 - hypothetical protein (Protein is coded in complementary strand; from 1344374 to 1344090)