Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 1363748
End position: 1363774
Length: 27

DNA sequence
>NC_014297, from 1363748 to 1363774 (27 bp); Halalkalicoccus jeotgali B3 CCTCGCCGACCTCGACGACCTCGCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1362817-1363962	Sequence	HacjB3_07305 - alcohol dehydrogenase GroES domain-containing protein (Protein is coded in complementary strand; from 1363962 to 1362817)