Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 152355
End position: 152378
Length: 24

DNA sequence
>NC_014297, from 152355 to 152378 (24 bp); Halalkalicoccus jeotgali B3 CGTTCGCGTTGGCGCTCGCGTGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 152028-152405	Sequence	HacjB3_00740 - hypothetical protein (Protein is coded in complementary strand; from 152405 to 152028)