Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 1775755
End position: 1775781
Length: 27

DNA sequence
>NC_014297, from 1775755 to 1775781 (27 bp); Halalkalicoccus jeotgali B3 GTCTTCGTCGTTTTCGTCGTCCTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1775585-1777030	Sequence	HacjB3_09595 - poly(R)-hydroxyalkanoic acid synthase subunit PhaC (Protein is coded in complementary strand; from 1777030 to 1775585)