Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 1818386
End position: 1818412
Length: 27

DNA sequence
>NC_014297, from 1818386 to 1818412 (27 bp); Halalkalicoccus jeotgali B3 GCGTCGGCCGCGTCGGTCGCGTCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1818299-1819081	Sequence	HacjB3_09775 - 3-hydroxybutyryl-CoA dehydratase (Protein is coded in complementary strand; from 1819081 to 1818299)