Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2175462
End position: 2175488
Length: 27

DNA sequence
>NC_014297, from 2175462 to 2175488 (27 bp); Halalkalicoccus jeotgali B3 GTCCTCGTCGTCCTCCTCGTCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2175220-2175837	Sequence	HacjB3_11740 - hypothetical protein (Protein is coded in complementary strand; from 2175837 to 2175220)