Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2228121
End position: 2228144
Length: 24

DNA sequence
>NC_014297, from 2228121 to 2228144 (24 bp); Halalkalicoccus jeotgali B3 CGGCCGTCCGGTCGTCGGGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2227565-2228419	Sequence	HacjB3_12025 - hypothetical protein (Protein is coded in complementary strand; from 2228419 to 2227565)