Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2331047
End position: 2331082
Length: 36

DNA sequence
>NC_014297, from 2331047 to 2331082 (36 bp); Halalkalicoccus jeotgali B3 CGGCGGTCCCGGTGGTCCCGGCGGCCCGGGCGGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2330176-2331111	Sequence	HacjB3_12560 - rhomboid family protein/GlpG-like protein