Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2495781
End position: 2495804
Length: 24

DNA sequence
>NC_014297, from 2495781 to 2495804 (24 bp); Halalkalicoccus jeotgali B3 GCGTCGGCGGCGGCGTCGGCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2495667-2496059	Sequence	HacjB3_13550 - hypothetical protein (Protein is coded in complementary strand; from 2496059 to 2495667)