Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2496623
End position: 2496658
Length: 36

DNA sequence
>NC_014297, from 2496623 to 2496658 (36 bp); Halalkalicoccus jeotgali B3 CTCGCCGGGCTCGCCGGGCTCGTCGGGCTCGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2496099-2496899	Sequence	HacjB3_13555 - hypothetical protein (Protein is coded in complementary strand; from 2496899 to 2496099)