Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 271592
End position: 271618
Length: 27

DNA sequence
>NC_014297, from 271592 to 271618 (27 bp); Halalkalicoccus jeotgali B3 CGACCCGTTCGATCCGTTCGACCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 270519-271721	Sequence	HacjB3_01365 - cell surface protein/ lipoprotein (Protein is coded in complementary strand; from 271721 to 270519)