Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2751846
End position: 2751869
Length: 24

DNA sequence
>NC_014297, from 2751846 to 2751869 (24 bp); Halalkalicoccus jeotgali B3 TCGTCGTCGGCGTCTTCGTCCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2751843-2752262	Sequence	HacjB3_14915 - 30S ribosomal protein S6e (Protein is coded in complementary strand; from 2752262 to 2751843)