Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 2806676
End position: 2806702
Length: 27

DNA sequence
>NC_014297, from 2806676 to 2806702 (27 bp); Halalkalicoccus jeotgali B3 GTCGCGACCGTCGCGATCGTCGCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2805977-2806759	Sequence	HacjB3_15235 - CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyl-transferase (Protein is coded in complementary strand; from 2806759 to 2805977)