Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 419308
End position: 419332
Length: 25

DNA sequence
>NC_014297, from 419308 to 419332 (25 bp); Halalkalicoccus jeotgali B3 GTCGCGTCCCGTCGAGTCGGGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 418764-419399	Sequence	HacjB3_02165 - pyrrolidone-carboxylate peptidase (Protein is coded in complementary strand; from 419399 to 418764)