Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 456024
End position: 456059
Length: 36

DNA sequence
>NC_014297, from 456024 to 456059 (36 bp); Halalkalicoccus jeotgali B3 GAGGATCGGCATGAAGATCGGCACGAGGATCGTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 455782-457086	Sequence	HacjB3_02360 - TRAP dicarboxylate transporter subunit DctM (Protein is coded in complementary strand; from 457086 to 455782)