Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 47752
End position: 47787
Length: 36

DNA sequence
>NC_014297, from 47752 to 47787 (36 bp); Halalkalicoccus jeotgali B3 GCCGCCCATGCCGCCCATACCGCCCATGCCGCCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 47744-49396	Sequence	HacjB3_00205 - thermosome (Protein is coded in complementary strand; from 49396 to 47744)