Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 735923
End position: 735958
Length: 36

DNA sequence
>NC_014297, from 735923 to 735958 (36 bp); Halalkalicoccus jeotgali B3 GCCGCCCATGCCGCCCATACCGCCCATGCCACCCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 735915-737603	Sequence	HacjB3_03710 - thermosome (Protein is coded in complementary strand; from 737603 to 735915)