Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 77693
End position: 77716
Length: 24

DNA sequence
>NC_014297, from 77693 to 77716 (24 bp); Halalkalicoccus jeotgali B3 GGCGACGGCGTCGACGACGGTGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 76953-78086	Sequence	HacjB3_00350 - cobalamin synthesis protein P47K (Protein is coded in complementary strand; from 78086 to 76953)