Sequence retrieval

Genome: Halalkalicoccus jeotgali B3
Start position: 988490
End position: 988513
Length: 24

DNA sequence
>NC_014297, from 988490 to 988513 (24 bp); Halalkalicoccus jeotgali B3 ATCGAACTCGAACTCGAACTCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 988167-988817	Sequence	HacjB3_05165 - hypothetical protein (Protein is coded in complementary strand; from 988817 to 988167)