Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1254689
End position: 1254712
Length: 24

DNA sequence
>NC_014310, from 1254689 to 1254712 (24 bp); Ralstonia solanacearum PSI07 CGGTGGCGGCGGCCGTGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1253305-1254924	Sequence	RPSI07_mp1036 - dipeptide-ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 1254924 to 1253305)