Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 1306321
End position: 1306344
Length: 24

DNA sequence
>NC_014310, from 1306321 to 1306344 (24 bp); Ralstonia solanacearum PSI07 GCGGCGGCGGTGGTGGCGGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1305251-1308346	Sequence	RPSI07_mp1077 czcA cobalt-zinc-cadmium resistance protein czca (cation efflux system protein czca)