Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 262079
End position: 262102
Length: 24

DNA sequence
>NC_014310, from 262079 to 262102 (24 bp); Ralstonia solanacearum PSI07 GCAGCCGCTGCCGCAGGCGCTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 262008-262325	Sequence	RPSI07_mp0216 - hypothetical protein (Protein is coded in complementary strand; from 262325 to 262008)