Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 391711
End position: 391734
Length: 24

DNA sequence
>NC_014310, from 391711 to 391734 (24 bp); Ralstonia solanacearum PSI07 TCATCATCACCATCACCAGCATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 391626-392414	Sequence	RPSI07_mp0329 fliR flagellar biosynthesis protein FliR (Protein is coded in complementary strand; from 392414 to 391626)