Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 398093
End position: 398116
Length: 24

DNA sequence
>NC_014310, from 398093 to 398116 (24 bp); Ralstonia solanacearum PSI07 TAGCTACAGCTACAGCTACAGCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 396360-398096	Sequence	RPSI07_mp0336 - modulator of rnase ii stability, signal transduction protein eal-ggdef domains (gmr)
ORF... 398115-398747	Sequence	RPSI07_mp0337 vsrD LuxR family transcriptional regulator (Protein is coded in complementary strand; from 398747 to 398115)