Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 628687
End position: 628710
Length: 24

DNA sequence
>NC_014310, from 628687 to 628710 (24 bp); Ralstonia solanacearum PSI07 CCTATACCCATACCCATACCTATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 628707-629351	Sequence	RPSI07_mp0479 - transcriptional regulator, tetr family (Protein is coded in complementary strand; from 629351 to 628707)