Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 835305
End position: 835328
Length: 24

DNA sequence
>NC_014310, from 835305 to 835328 (24 bp); Ralstonia solanacearum PSI07 GCGCCAGCGCCAGCTCCAGGGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 835136-836020	Sequence	RPSI07_mp0681 - hypothetical protein (Protein is coded in complementary strand; from 836020 to 835136)