Sequence retrieval

Genome: Ralstonia solanacearum PSI07
Start position: 911011
End position: 911034
Length: 24

DNA sequence
>NC_014310, from 911011 to 911034 (24 bp); Ralstonia solanacearum PSI07 GCCACCGCCACCGCCGCCGCAACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 909410-911146	Sequence	RPSI07_mp0743 - hypothetical protein (Protein is coded in complementary strand; from 911146 to 909410)